Meanwhile, back at the university, Raine was conducting her evening lecture for postgraduate students in Biology. Outside, clusters of undergraduates from the Technology Department roamed the campus, their classes stretching late into the evening like hers.
Raine sat quietly at the back of the lecture hall, her gaze steady on the student presenting at the front. With her hands clasped beneath her chin, she leaned slightly forward, lost in thought yet attentive, her eyes sharp and observant as she took in every word of the report.
"Clustered Regularly Interspaced Short Palindromic Repeats, or CRISPR," Nikki Jaye Watson began, standing confidently before the class, her presentation adorned in a soft pink palette that subtly commanded attention. "This sequence is part of the bacterial genome that produces RNA molecules, while Cas-short for CRISPR-associated protein-refers to a DNA-cutting enzyme."
Her voice remained steady as she continued, "Although earlier gene-editing techniques existed, the CRISPR-Cas system has now become the preferred method for gene modification. Its advantages? It's more efficient, accurate, versatile, and easy to apply. CRISPR-Cas9, in particular, is reshaping the world of genetic science. This tool is not only faster and cheaper than past DNA-editing methods but is also remarkably precise, opening doors to countless applications."
"Yes, I understand the fundamentals," Raine replied with a raised eyebrow. "But I want to hear your understanding of how CRISPR operates. Explain it in a way that reflects the depth of your knowledge. If you can't convey the concept clearly, how will you teach it to others, especially your students?"
Nikki took a steadying breath, her gaze fixed on Raine as she advanced the presentation slide. "Scientists found that around forty percent of bacteria contain clusters of regularly spaced, repeating sequences," she began, her voice trying to become steady. "These sequences, which read the same forwards and backwards, are palindromic."
She gestured to the display, where two sequences were highlighted: "Here, for example, CAATAACTTCAAAAGTATTG, paired with GTTATTGAAGTTTTCATAAC. These palindromic sequences are the CRISPR regions. They act like genetic memories of viral invasions, allowing bacteria to recognize and defend against future attacks by similar viruses."
"Correct-those are palindromes," Raine replied, her gaze intent. "Now, what about the random nitrogen bases between them?"
"They're called spacers, and that's why it's named Clustered Regularly Interspaced Short Palindromic Repeats," Nikki explained, her tone steady, though a hint of uncertainty lingered.
Raine tilted her head slightly, her eyes probing. "Alright, but what's the significance of these spacers? Why do they exist between the repeats?"
"Erm... at first, they concentrated on the palindromic repeats, but then... the real secret lay in the spacers," she answered.
"Go on," Raine urged.
"There was a scientist, Francisco Mojica from Spain, who discovered that these spacers matched DNA found in viruses, specifically bacteriophages," Nikki explained. "It turned out that CRISPR acts as a kind of immune system for bacteria. During a bacteriophage infection, the bacterium can snip a segment of viral DNA and insert it into its own genome, creating a memory of the invader to better defend against it in future attacks."
"Alright, but could you put it more simply?" Raine asked.
Nikki paused, considering her words. "Ms. Watson?" Raine prompted. "Perhaps an anagram or something similar?"
"Alright, so... imagine you're typing a document," Nikki began. "To spot a misspelled word, you might press F7 or use the spell check feature to find it. Once found, you can edit or delete it. For DNA, that's essentially what CRISPR/Cas9 does."
YOU ARE READING
The Missing Link
Misterio / Suspenso4× Featured In the once peaceful town of Nueva Aurora, a string of gruesome murders shakes the community to its core. Victims are left heartless--literally-- after their organs are surgically removed. Science teacher Lorraine de Verra, with dreams o...
