Tremble

Chapter 15: The Machine

My eyes flicker across the blank and barren ceiling, back and forth, over and over. This place has felt more and more like home the longer I stay here, but yet I still cannot fall asleep, at night the place feels sad and empty. Wind funnels through the halls making a soft low wailing sound, it echoes throughout the halls. Otherwise there is no sound, no snores, no rustling, no life.

I swing my legs off the bed and make my way toward the door. I decided it'd be best to take a walk around the base, after all I still haven't been around the entire place, I've only stayed in the west wing. The complex was made up of housing, labs, meeting rooms, training rooms, multiple library's, and a cafeteria. The library's have been where I've spent much of my time studying gene sequences and mutation. I often wondered if the government had planned for gene contamination, or if it simply was a shameful incident.

Outside my room was a long hall leading to much of the housing complex, at the end of the hall was a meeting room and adjacent to the meeting room door was a hall leading into the lab complex, all the rooms leading into one another. I walked by the lab door and I heard a loud whirring. A blue light flickered back and forth through the crack in the wooden frame of the door. The door was unlocked and I went to investigate. This lab room 1B was the largest, it composed of many different devices, it was the room I had my little mental breakdown. Since then the lab has been cleaned up and taken care of since then everything shined with a sparkling gleam. The light was coming from a large device I was unfamiliar with. It looked over all the other equipment, made of some stainless steel vibranium hybrid, it looked like something straight out of an Arthur C. Clarke novel.

I picked my way through the isle of centrifuges, all lined up on either side of me. The device appeared to have some readings on its display screen.

ATGCATGCATGCATGCATGCATGC

The sequence continued on for roughly five more inches down the screen. A general genome sequence, initially I saw nothing wrong with it. I was about to move on with my walk until I heard someone clomping down on the floorboards outside. Suddenly I felt strangely compelled to hide, there was nothing wrong with me wondering at night, but I felt that I shouldn't be messing with whatever this device is. I ducked under the table that was behind the centrifuge and sulked in the corner holding my knees to my chest the best I could. I attempted to restrain my breathing, slow shallow breaths. The steps became louder and I heard heavy breathing as if someone had been sprinting. I could only get a small glimpse at their feet and I was unable to recognize who it was. I heard a collective number of high pitched beeps and a disgruntled sigh. The steps grew softer until the only sound in the lab was the humming of the machine. I crawled out and too my surprise the lab remained almost untouched, except for one small detail. A bright yellow post-it note was stuck on the machine, it read:

"I know you were here tonight, let's hope I never see you here at night again."

I grabbed the note and stuck it in my pocket, I felt it best I told no one of tonight's events. Before I left I glanced back at the screen.

ATGCATGCATGCAUGCATGC

This slightest of difference seemed impossible to me, there was no way, yet I stood here looking at it.