Note: I know I never mentioned anything about [J]. But this is a new point of view, on the third person. Read On. Apologies for the sudden notice and also apologies for the near future, in case I have done something wrong ¯\_(ツ)_/¯
____________________________________________________________________________________
It had been another terrible day for Jasper VI. His father, Jasper V, had died due to lung cancer the other day. And to add up to the sadness of his loss, he received a coded telegram from one known only as 'D'.
"AGGGGGGGATACTCTTTGGACTTGGGTGCATCGTTGGGCGCAGTAGTTGGAGCTTTGTCTTAGTTGTCCGGATCTTCCGTAGGATGCGGATTGTCTGGTGGATTGCTCGTATAAGGATTGCCGGCAGCGGGTGTATACGGATTTAACATGTTGAGGTGGGCAGTATCTGTATACGGGTTGGGCTGATCCTCTGGTGGATCCTTGTAGTCCGCTGGATCCTCGTTTAACATGTTGATC"
After decoding it through a DNA encoder which he invented, he re-read the message
"Agent X has failed to retrieve the Time Machine. Awaiting further orders. D"
"Well bummer, I knew he was incapable," he thought to himself. After taking leave from his father's funeral, Jasper VI went back home. He went inside his office, at the wall to his left, hung a painting of a lady, still in her prime. Jasper VI took the painting off and revealed a secret backdoor. After verifying his presence using a fingerprint scan, retina scan and voice match, the door opened, revealing his true office.
He went down the cobblestone stairs and sat on his chair. He turned on his computer and selected a CCTV recording from an abandoned factory in upstate New York. He saw it all, the laser, the disintegration, and the disappointment. He turned his chair around. Before him, was his butler, Francis and four different enhanced agents, still inside their pods experiencing cryosleep*. Each pod had the names, Alpha, Beta, Gamma and Omega. Jasper VI remembered the day they were brought to creation, each and every one of them succeeded the other, with Omega being the strongest. These people made Agent X look like he is Mahatma Gandhi. Agent X's DNA were taken from Alpha's own DNA, which meant he was only a fraction of what Alpha was. They were created during The Winter War which happened between Soviet Union and Finland. After their creation by the ingenious Jasper the First, the war ended, with the Soviets earning victory overnight. There were no boundaries that could limit what these people could do.
Jasper VI looked at his butler, Francis. "Initiate Project Awakening, we have some work to do," Francis turned pale and slowly lowered his head down.
"Sir, are you sure...For all we know, this could end the world as we know it," Francis asked his master. Jasper VI looked right at Francis's face and smiled.
"When the world's got to end, it's got to end. Wake them. Now!"
Francis felt a rush of fear run through his veins, and fighting against his will, he woke the enhanced agents all from the cryosleep. One by one, each of them knelt before Jasper VI, until Omega stood up and looked at Jasper's eyes. "Ready to comply,"
"It's time,"
Omega smirked. "It really is about damn time."
*cryosleep: A deep sleep during which the body is stored at very cold temperature, to preserve it
____________________________________________________________________________________
Apparently this is the near future, and I apologise for the cliffhanger. Actually not sorry for anything.
¯\_(ツ)_/¯
There are two ways this can go down....
1. I continue this story in another book
2. I end it here
Comment on which way you prefer...I'll be waiting
YOU ARE READING
Runner (Completed)
Teen FictionAlex has just invented a time machine, and he has already got someone on his tail chasing him. Along with the help of Cassie and Sergeant Doe, Alex will have to face his ultimate adversary, Agent X. Alex is only a physicist, but there is more to him...